Probe/primer details
| SPH492 | Tested for in situ hybridization. |
| Accession no. | pB-919 |
| Taxonomy | Sphingomonadales; Alphaproteobacteria; Proteobacteria; Bacteria |
| Specificity | Sphingomonas, Erythrobacter |
| Competitor | 5'-TAG CCG GAG CTT ATT CTG -3' |
| Target rRNA | 16S rRNA |
| Position | 492-509 |
| Sequence | 5'- TAG CCG GAG CTT ATT CTC -3' |
| G+C content [%] | 50 |
| Length [nt] | 18 |
| Check specificity/coverage | 
|
| Formamide [%] | 20 |
| Hybridization efficiency |  |
| References | Microbial community and physicochemical analysis of an industrial waste gas biofilter and design of 16S rRNA-targeting oligonucleotide probes. Friedrich U, Van Langenhove H, Altendorf K, Lipski A. Environmental microbiology. 2003. Pubmed |
| Remarks | molar ratio of competitor oligonucleotide versus probe is 1 helper oligonucleotides: H433, ATCCCKGGTAAAAGAGC, H450, CMGRTACTGTCATTATC, H510, CGGCTGCTGGCACGGAGT, H528, CTAGCTCCCTCCGTATTACCG |
Glossary
Name (Alm et al., 1996). Probe designation according to Alm, E. W., Oerther, D. B., Larsen, N., Stahl, D. A., Raskin, L. (1996). The oligonucleotide probe database. Appl Environ Microbiol 62: 3557-9. Abstract (PUBMED).
Position. Probe position according to the E. coli gene numbering.
Sequence. Sequence in IUPAC code: R=G/A, Y=T/C, M=A/C, K=G/T, S=G/C, W=A/T, H=A/C/T, B=G/T/C, V=G/C/A, D=G/A/T, N=G/A/T/C
Tm. Dissoziation temperature according to: Tm=64.9 + 41 x ((G + C - 16.4)/length).
Hybridization efficiency. Use this tool to assess in silico sensitivity (i.e. the hybridization efficiency of the oligonucleotide with its fully complementary target sequence, calculated with ProbeMelt.
Formamide. Percent formamide in the hybridization buffer for optimal hybridization conditions in FISH experiments.
Coverage. Coverage of the three domains calculated using the SILVA reference database 106 if no or a single mismatch is allowed. The detailed method is described in Klindworth et al., 2012. Nucleic Acids Res. 10.1093/nar/gks808 Full Text
Check specificity/coverage. Use these options to reveal the in silico specificity (i.e. number of matching rRNA sequences outside the target taxon) and coverage (i.e. percentage of matching rRNA sequences within the target taxon) of an oligonucleotide against the most recent SSU and LSU rRNA sequence databases.
