| GALTS0084 | Tested for in situ hybridization. |
| Accession no. | pB-1210 |
| Taxonomy | Gallionella ferruginea [1]; Gallionella [1]; Gallionellaceae [1]; Gallionellales [1]; Betaproteobacteria [1]; Proteobacteria [1]; Bacteria [1] |
| Specificity | acid mine drainage clones related to Gallionella ferruginea |
| Category | extremophilic microbes [1] |
| Target rRNA | 16S rRNA |
| Position | 84-101 |
| Sequence | 5'- CCA CTA ACC TGG GAG CAA -3' |
| G+C content [%] | 56 |
| Length [nt] | 18 |
| Check specificity/coverage |  [2]
|
| Formamide [%] | 40 |
| Hybridization efficiency |  [2] |
| References | Macroscopic streamer growths in acidic, metal-rich mine waters in north wales consist of novel and remarkably simple bacterial communities. Hallberg KB, Coupland K, Kimura S, Johnson DB. Applied and environmental microbiology. 2006. Pubmed [2] |
| Remarks | Requires helper oligonucleotides, unlabelled and added in equal concentrations to that of the probe. They are GALTS h1 = GATATATTACTCACCCGTTCG and GALTS h2 = GCCCCCAGGCCCGTTCGA. |
Print [1]
Glossary
Name (Alm et al., 1996). Probe designation according to Alm, E. W., Oerther, D. B., Larsen, N., Stahl, D. A., Raskin, L. (1996). The oligonucleotide probe database. Appl Environ Microbiol 62: 3557-9. Abstract (PUBMED) [2].
Position. Probe position according to the E. coli gene numbering.
Sequence. Sequence in IUPAC code: R=G/A, Y=T/C, M=A/C, K=G/T, S=G/C, W=A/T, H=A/C/T, B=G/T/C, V=G/C/A, D=G/A/T, N=G/A/T/C
Tm. Dissoziation temperature according to: Tm=64.9 + 41 x ((G + C - 16.4)/length).
Hybridization efficiency. Use this tool to assess in silico sensitivity (i.e. the hybridization efficiency of the oligonucleotide with its fully complementary target sequence, calculated with ProbeMelt [2].
Formamide. Percent formamide in the hybridization buffer for optimal hybridization conditions in FISH experiments.
Coverage. Coverage of the three domains calculated using the SILVA reference database 106 if no or a single mismatch is allowed. The detailed method is described in Klindworth et al., 2012. Nucleic Acids Res. 10.1093/nar/gks808 Full Text [2]
Check specificity/coverage. Use these options to reveal the in silico specificity (i.e. number of matching rRNA sequences outside the target taxon) and coverage (i.e. percentage of matching rRNA sequences within the target taxon) of an oligonucleotide against the most recent SSU and LSU rRNA sequence databases.