DEF988 | Tested for in situ hybridization. |
Full name (Alm et al. 1996) |
S-S-Bact-1020-a-A-22 |
Accession no. | pB-1203 |
Taxonomy | Defluviicoccus vanus [1]; Defluviicoccus [1]; Rhodospirillaceae [1]; Rhodospirillales [1]; Alphaproteobacteria [1]; Proteobacteria [1]; Bacteria [1] |
Specificity | Defluvicoccus vanus-related organisms, cluster 2 |
Target rRNA | 16S rRNA |
Position | 988-1009 |
Sequence | 5'- GAT ACG ACG CCC ATG TCA AGG G -3' |
G+C content [%] | 59 |
Length [nt] | 22 |
Check specificity/coverage | ![]() |
Formamide [%] | 35 |
Hybridization efficiency | ![]() |
References | Putative glycogen-accumulating organisms belonging to the Alphaproteobacteria identified through rRNA-based stable isotope probing. Meyer RL, Saunders AM, Blackall LL. Microbiology (Reading, England). 2006. Pubmed [2] |
Remarks | helper probes: pos966-987 CTGGTAAGGTTCTGCGCGTTG, pos1038-1064 AGCGCCATGCAGCACCTGTGTGGCGT |
Print [1]
Glossary
Name (Alm et al., 1996). Probe designation according to Alm, E. W., Oerther, D. B., Larsen, N., Stahl, D. A., Raskin, L. (1996). The oligonucleotide probe database. Appl Environ Microbiol 62: 3557-9. Abstract (PUBMED) [2].
Position. Probe position according to the E. coli gene numbering.
Sequence. Sequence in IUPAC code: R=G/A, Y=T/C, M=A/C, K=G/T, S=G/C, W=A/T, H=A/C/T, B=G/T/C, V=G/C/A, D=G/A/T, N=G/A/T/C
Tm. Dissoziation temperature according to: Tm=64.9 + 41 x ((G + C - 16.4)/length).
Hybridization efficiency. Use this tool to assess in silico sensitivity (i.e. the hybridization efficiency of the oligonucleotide with its fully complementary target sequence, calculated with ProbeMelt [2].
Formamide. Percent formamide in the hybridization buffer for optimal hybridization conditions in FISH experiments.
Coverage. Coverage of the three domains calculated using the SILVA reference database 106 if no or a single mismatch is allowed. The detailed method is described in Klindworth et al., 2012. Nucleic Acids Res. 10.1093/nar/gks808 Full Text [2]
Check specificity/coverage. Use these options to reveal the in silico specificity (i.e. number of matching rRNA sequences outside the target taxon) and coverage (i.e. percentage of matching rRNA sequences within the target taxon) of an oligonucleotide against the most recent SSU and LSU rRNA sequence databases.